aaliyahlewis770 aaliyahlewis770

21-09-2022
English

contestada

Write an argumentative essay for an entertainment magazine in which you claim either
that a movie theater or a smaller screen (smartphone, tablet, laptop, etc.) provides
the best experience. Us information from the passages in your essay.

Respuesta :

Otras preguntas

Which lines in this excerpt from Mary Otis Warren's poem "A Political Reverie" use figurative language? I look with rapture at the distant dawn , And view the g

A cylindrical can of cat food has a diameter of 3.5 inches and a height of 1.25 inches A second brand of cat food is packaged in a cylindrical can with a radius

if an element has more than one ionic caves how was that piece of information represented in a chemical name?

why is the work output always less than the work input?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Do any of these represent a linear function (just state letters if they do)

what percent of 137.4 is 96

What is a vestigial organ

Write a recursive function for this sequence 8,12,18,27..

Jonathan has a collection of 400 marbles. Blue marbles make up 17%, percent of his collection. How many blue marbles does Jonathan have?