lippy2483 lippy2483
  • 21-11-2022
  • Mathematics
contestada

mathoverflow how many ways are there to split the integers $1$ through $14$ into $7$ pairs such that in each pair, the greater number is at least $2$ times the lesser number?

Respuesta :

Otras preguntas

How can one concentrate in studies ?
An ovule can be defined as:
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Please I need help quickly I'm on a time limit
what stress force on a reverse fault?
6 is 12% of what number
What event takes place in the second entry of Anne Frank's dairy?
7- What types of RNA are present in a cell and how can you selectively make copies of only the mRNAs?
find the value of x using the measures of the two given adjacent supplementary angles
1. Obligate anaerobes are often grown in an anaerobe jar, which completely excludes oxygen from the environment. How is the environment within a tube of fluid t