anonymoususer314 anonymoususer314
  • 25-11-2022
  • Mathematics
contestada

a 60.9 kg person is standing in an elevator that is moving upwards and slowing down at a rate of 3.9 m/s^2 what is the apparent weight of the person

Respuesta :

Otras preguntas

What is the answer to 8xsquared-24x
Discuss the consequences of poor wound management.
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
14. Which of Canada's Atlantic Provinces has jurisdiction over mainly uninhabited Labrador?
Which of the following tactics do food manufacturers use to try to get you to buy their products? a. TV and radio commercials b. all of the above c. coupons d.
A cargo plane flew to Moscow and back. It took six hours longer to go there than it did to come back. The average speed on the trip there was 152 mph. The avera
The tube that connects the bladder and the outside is called the
A department store purchases a dress for $80. To sell the dress to customers, the price is marked up by 19%. You hand the clerk $110. How much change will you
Suggest a reason why food labels provide information about the energy released by the food?
The Glorious Revolution of 1688 demonstrated that Parliament had