kevinmedina0902 kevinmedina0902

22-01-2023
Biology

contestada

DNA Never leaves the Nucleus of the cell. This is why you need RNA. In Transcription, DNA is
transcribed into a strand of RNA.
DNA has Adenine, Thymine, Cytosine, Guanine
RNA has Adenine, Uracil, Cytosine, Guanine
Transcription of DNA to RNA
ATGCCTAAGCCGTGTCCGAT

Respuesta :

Otras preguntas

What is the solution to 11 = x – 4?

if 150 empty water bottles weigh 4.5 pounds, what would you expect 90 empty water bottles to weigh?

Isopropyl alcohol cause DNA to do what?

A drinking glass is shaped like a cylinder with a height of 12 cm and a radius of 4 cm. Maeva adds 25 spherical pieces of ice to the glass. The pieces of ice ea

What two numbers multiply to 24 and add to 23?

the main pigment found in the chloroplasts of plants is

Most people of West and Central Africa support themselves through which means?

Explain why trees are a renewable resource and how this resource can be maintained.

What is the opposite of evaporation? How do these processes differ?

Friedan interviewed many women who were not happy with their suburban lives and she eventually worked to change society's expectations for women. A.True B.False