basketball1373 basketball1373
  • 23-01-2024
  • Mathematics
contestada

Calculate each quotient using equivalent fractions. a) 5 / (1/3)

A) 15
B) 10
C) 2/3
D) 1/15

Respuesta :

Otras preguntas

If the area of a rectangle is 40" and the perimeter is 48", what are the side lengths of the rectangle?
· Heart muscle receives its oxygen and nutrient supply from o atria o ventricles o aorta o pulmonary veins o coronary arteries · The "cushion" between bones in
How do short-term goals differ from long-term goals?
what is the main point being made by the cartoonist documeny E
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Where can the resource for this ocean type be found?
Find the mean of these values 6,4,8,2,5
why is the work output always less than the work input?
of elements N, O, Cl, Na, and Which two would likely have similar chemical properties and why
Where does the water in streams and rivers originate? a. precipitation b. runoff c. ice and snowpacks d. all of the above