nosabokid42315 nosabokid42315
  • 25-01-2024
  • Mathematics
contestada

Tulsa buys a shirt for d dollars she uses a 50$ gift card and receives the change shown

Respuesta :

Otras preguntas

I need some help A rectangular prism with 6 square faces is called A)square B)polygon C)Cube D)Rhombus
When it comes to the movement of air, friction A. increases with altitude. B. is greater near the ground surface. C. diminishes turbulence. D. is respon
All living organisms carry out certain activities which make them different from inanimate objects. Which one of the following lists shows three activities of
Why did Japan aggressively expand in the 1930s?
What is the molar solubility of MgF2 in a 0.36 M Mg(NO3)2 solution? For MgF2, Ksp = 8.4 × 10^–8
Is 3+x always going to equal x+3
3х + 5y – 20 =0how do I find the slope and y intercept?​
A definition context clue is:
What is the interquartile range of the given data set? 8, 9, 12, 21, 30, 55, 64, 71, 99, 101 93 0 75 59
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid