jason7890 jason7890
  • 25-05-2018
  • Mathematics
contestada

some help me please help me please help me please help me please help me please help me please

some help me please help me please help me please help me please help me please help me please class=

Respuesta :

elangelitoyeisp95ia3
elangelitoyeisp95ia3 elangelitoyeisp95ia3
  • 25-05-2018
Ok so in order to do that you need a calculator
Answer Link
abbycutiequeen
abbycutiequeen abbycutiequeen
  • 23-04-2020

Answer:

210+90=300

Step-by-step explanation:

I am no cap smart

Answer Link

Otras preguntas

Who discovered polio vaccine
what does hafa adai mean in guamanian
Describe the fluid theory of intelligence; then explain your views on the theory
10(x+3)=9 mmmmmmmmmmmmmmmmm
one reason President Johnson created the Great Society program was to
Juliana’s exercise partner is running a high fever and feels nauseous. She also has a rapid heart rate. What should Juliana do? Get warm food Stay in the sun
the volume of a sphere is 950 cubic inches. Use the formula for the volume of a sphere to find the radius to the nearest tenth of an inch
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
what is the solution of the following question? x^2+10x+25=12
A cylindrical can of cat food has a diameter of 3.5 inches and a height of 1.25 inches A second brand of cat food is packaged in a cylindrical can with a radius