2001bullitt 2001bullitt
  • 22-02-2019
  • English
contestada

1. What can search the Internet and select elements based on important words?

Respuesta :

YourNunny
YourNunny YourNunny
  • 22-02-2019

1. What can search the Internet and select elements based on important words? - a browser

Answer Link

Otras preguntas

a single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
The first step in approving the Constitution involved sending it to A.) The states. B.) Congress. C.) The Judicial branch. D.) The Executive branch.
Which of the following was the most successful product during the colonial period?
Which word means most nearly the same as advance? 01. motion 2. action 3. program 4. gain
Which of the following is true about why people develop into who they are? A. They develop from the influence of their environment. B. They are born with the pe
When attempting to study for her next Science exam, Alma cannot arrange her notes into the correct order. What has Alma forgotten to do? a. Include the name of
What are the roles of a citizen responder in an emergency
Solve for d. 1.2+d+0.4=9.7 Enter your answer as a decimal in the box.
Find the limit............​
how is an electron orbital similar to a parabola?