dagoodrich35 dagoodrich35
  • 24-05-2019
  • History
contestada

What was a goal of the New Right?

Respuesta :

calebantrim1
calebantrim1 calebantrim1
  • 24-05-2019

Answer:

To roll back liberal policies on foreign affairs, abortion, taxation, and government control over american life in general.

Explanation:

Answer Link

Otras preguntas

How can global warming lead to changes to the Earth’s surface? a. Global warming can lead to an increased number of earthquakes, which change the Earth’s surfac
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Mantle convection is a circulation of heat emitted by the earths... A) core B) crust C) lithosphere D) atmosphere
What name was given to the Allied plan to invade France?
. A ski club planned a trip to Lake Tahoe, and 40 of the members signed up to go. If this is 60% of the club, how many members does the ski club have in total
what percent of 137.4 is 96
Rulers of the Zhou dynasty established the Mandate of Heaven to ________.
What is the answer to 8xsquared-24x
Prolonged use of antipsychotics may lead to ______ in adults..... extrapyramidal effects and tardive dyskinesia parkinsonism-like symptoms neither a or b both a
Explain the importance of spore formation for both eukaryotes and prokaryotes.