Seudónimo Seudónimo

24-11-2019
Mathematics

contestada

Please answer this correctly

Please answer this correctly class=

Respuesta :

Yang100 Yang100

24-11-2019

Answer:

7:52 PM

Step-by-step explanation:

4:08+55=5:03 PM

5:03+1:50=6:53 PM

6:53+59=7:52 PM

Answer Link

leslyandamado4ever leslyandamado4ever

24-11-2019

Step-by-step explanation:

7:52pm sounds like the correct answer

Answer Link

Otras preguntas

Megan raises £1,720 from a sponsored walk. She splits this between two charities, Young People Into Business and Keeping It Clean, in a ratio of 5:3. How much d

for the reproduction practical it is important

A força gravitacional sobre uma bola de beisebol é de -Fg j. Um arremessador lança a bola com velocidade vi acelerando-a uniformemente para frente, horizontalme

The length of a rectangular photograph is 9 in more than the width. If the area is 90 in², what are the dimensions of the photograph? The photograph is how much

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

What are some examples of secretory cells?

The graph of y = -0.2x² is ____ the graph of y = x²

shkole 2. Réponds aux questions. 1. De quoi parle ce texte ? 2. Où se trouve la ville de Kamyanets-Podilsky ? Peux-tu trouver cette Yah hoje vshkole ville sur l

please can you help me?? Thanks!

Solve the following pairs of Simultaneous equation 2y-X = 4 2x² + 3y² -x+4y=17