princesamuel
princesamuel princesamuel
  • 26-01-2020
  • Mathematics
contestada

Make p the subject in m=pq+rq(2)​

Respuesta :

josshyaby
josshyaby josshyaby
  • 26-01-2020

Answer:

Step-by-step explanation:

m=pq+rq(2)​

Opening bracket

m = pq + 2rq

m - 2rq = pq

Dividing each term q

(m - 2rq)/q = pq/q

p = (m - 2rq)/q

Answer Link

Otras preguntas

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I
Find the Distance between -7 and 9 on the real number line.
What are some quotes from, "The Fall of Usher House" by Edgar Allen Poe that has imagery?
The cross-section of the prism below is a compound shape formed of two rectangles. Calculate the surface area of this prism. Give your answer in cm².
Line WY is the perpendicular bisector of segment AB.
Please i need help, can someone help me pls :​
A bicycle is traveling at 18 miles per hour. How many feet will it cover in 40 seconds? Round your answer to the nearest tenth of a foot. ​
What percentage (to the nearest tenth) of the total hours were completed by students other than Patrick?
the diagram represents apparatus used to investigate osmosis pls help pls pls pls
Chlorpheniramine 100 ml Lidocaine 2 oz Banana flavoring ½ tsp Take 10 ml BID How many days will this solution last?