tybug1028 tybug1028

26-03-2020
Mathematics

contestada

a(1) = 20
(a(n) = a(n − 1) – 17
Find the 3rd term in the sequence.

Respuesta :

ebonybacas ebonybacas

02-04-2020

Answer:

I believe -14 is the third term

Step-by-step explanation:

Answer Link

Otras preguntas

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataatt

Bill is shopping for folders, notebooks and pencils for the first day of school. A notebook costs 4 times as much as colder. A notebook costs 2 times as much as

describe how oxygen gas and carbon dioxide create a cycle within the ocean HURRY 40 POINTS!!!!!!!!!!!!!!!!!!!!!!!!!! Give to BRAINLIEST ANSWER

what disturbing thing do the group of hunters and Ralph do immediately after their encounter with the pig? How is Ralph's behavior foreshadow

Question 11 (3 points) Question 11 Unsaved The equation x2 + (y + 3)2 = 36 models the boundary on a local map for which Darren can hear his friend Tom on his tw

is 9 feet greater than less than or equal to 4 yards

por que a mineração provocou um aumento do controle de Portugal sobre a colonia?

EASY POINTS All gas mixtures are _____. A) heterogeneous solutions B) heterogeneous compounds C) homogeneous multiple phases D) homogeneous solutions

Which country finally agreed to sponsor Columbus' voyage?

In order to determine how various organisms are related, scientists have organized them into classification groups called taxa. these groups are shown below, bu