luvxmimi luvxmimi
  • 23-04-2020
  • Biology
contestada

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC​

Respuesta :

Аноним Аноним
  • 23-04-2020

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

Answer Link
StephanyNo StephanyNo
  • 23-04-2020
AUGGGUAAUGCGCCGUUCGCAUUAAUG
Answer Link

Otras preguntas

Fill in the blank with the word that best completes the following sentence. Der Vater ______ Vaters heißt Wilhelm. A) meinen B) meiner C) meine D) meines
Question 5 What does Richard's fiancee hope to mold him into? O Aman of respect and fear. An aristocrat. O Amodel of sophistication. A doctor of great means.
What event covered by newspapers would lead to American involvement in the Spanish-American War?
You are dealt one card from a 52 card deck. Then the card is replaced in the deck, the deck is shuffled, and you draw again. Find the probability of getting a p
How do I factor w^2 + 16?
7. For which discriminant is the graph possible?A. b2 - 4ac = -12B. b2 - 4ac = 0C. b2 - 4ac = 7​
In a compare and contrast paragraph, a conclusion should: a. say that both things are the same c. both of these b. say which one is better d. none of these
What’s the correct answer for this?
Who created a list of rules for doctors? A.Thales B.Herodotus C.Thucydides D.Hippocrates
Please help I can’t find the answer for this question