luvxmimi luvxmimi

23-04-2020
Biology

contestada

Create the complement of the following DNA strand. TACCCATTACGCGGCAAGCGUAATTAC

Respuesta :

Аноним Аноним

23-04-2020

Answer:

This is the mRNA strand

Explanation:

AUGGGUAAUGCGCCUUCGCAUUAAUG

Answer Link

StephanyNo StephanyNo

23-04-2020

AUGGGUAAUGCGCCGUUCGCAUUAAUG

Answer Link

Otras preguntas

A record is spinning at the rate of 30 rpm. If a ladybug is sitting 8 cm from the center of the record, find and exact answer for each of the following. a) What

Gaseous ozone undergoes decomposition according to the stochiometric equation: 2O3 (g) → 3O2 (g) Two alternative mechanisms have been proposed to account for th

A substantial amount of genetic diversity is introduced during meiosis by shuffling combinations of maternal and paternal chromosomes into haploid gamete cells.

$8333 in savings with fixed rate of 8% compounded 2 times a year how much will it be in 12 years

a^ (log16b4-log4(64b2)

Determine the probable genotypic and phenotypic ratios expected from crossing two heterozygous plants of the above problem.

Not all science discoveries are based on experiments. Which would be best described as science based on exploration? 1) Experimentation 2) Observation 3) Resear

i need help with password game

Earnings per share is equal to net income applicable to common stock, divided by the weighted number of common shares outstanding?a.Trueb.False

150 ft 120 ft 160 ft x ft what is x