19681974mora
19681974mora 19681974mora
  • 25-04-2020
  • Mathematics
contestada

pls help pls pls pls pls

pls help pls pls pls pls class=

Respuesta :

Wallind11
Wallind11 Wallind11
  • 25-04-2020

Step-by-step explanation:

f(x)=(x-5)(5x +2)=0

=> x=5 or, x=-2/5

smaller x = -2/5

larger x=5

Answer Link
princess4days
princess4days princess4days
  • 25-04-2020

Answer:

The smaller x = -2/5

f(x)=(x-5)(5x +2)=0

The larger x = 5

Step-by-step explanation:

hope it helped :) please mark brainliest :)

Answer Link

Otras preguntas

Sharp pain is transmitted through which type of nerve fibers?
State two biological reasons why you consider that the loss of biodiversity matters.
physical components are connected to a cpu via the motherboard in all the following ways except
which of the following does NOT describe the process of summation? a. Two ESPSs are generated at the same time by two separate synapses, bringing the cell to th
1.True or false: It may be possible to save a significant proportion of Earth's biological diversity by establishing sustainable biological reserves at 25 locat
Multiple sclerosis is a demyelinating disease in which the patient's immune system attacks and destroys the cells that form the myelin sheath in the central ner
how did Thomas Edison contribute to the Industrial Revolution
can I get the answers for number 14 plz?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
What are the adaptive immune responses induced following acute and chronic infection with HIV?