Seudónimo Seudónimo
  • 25-08-2016
  • Mathematics
contestada

Find unit rate for 51 in 14 min.

Respuesta :

caseyjdishroon
caseyjdishroon caseyjdishroon
  • 25-08-2016
its going to be .27ths of an inch for 1 minute.
Answer Link
isaacrubendiaz
isaacrubendiaz isaacrubendiaz
  • 25-08-2016
16.47 is the answer pleese help on my question

Answer Link

Otras preguntas

What are the 5 steps to analyzing an argument
okay I told me it was two plus two please
DNA tacaggtacccgaacccaattta
The graph of g(x) is the graph of f(x)=x+9 reflected across the y-axis. Which equation describes function g? g(x)=x−9 g(x)=−9x+9 g(x)=−x+9 g(x)=−x−9
I believe i believe. Put this on spanish in the comment and i put you brainliest
Every study guide you use for a novel will have the answers already filled in. True or False
a football is thrown upward at a 31° angle to the horizontal.the acceleration of gravity is 9.8m/s^2. To throw the ball a distance 77 m, what must be the initia
Choose the verb from the word bank that best completes the sentence AND conjugate it. You only need to write the correct conjugation (not the whole sentence). W
can someone make a expanatory essay on harrison bergeron short story by kurt vonnegut please its due at 12:59pm tonight
which sentence best describes the context of "A Quilt of a Country"?