helenirby1964 helenirby1964
  • 22-05-2020
  • Chemistry
contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof
  • 22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

How did technology improve city life?
error uses 1/3 can of wet dog food for his dog,muddy,each day.how many servings will he get from 5 cans of dog food?
What is x over 2+ 4<7
What property does the equation 4+x+7=4+7+x
What narrow waterway was used to travel from Byzantium to Troy?
How did civilization led to irrigation
the year 2006 is the year 7 rabbit in the Aztec calendar what is the year 2010in the Aztec calendar
The length of a city’s bus routes are normally distributed with a mean of 14.5 mi and a standard deviation of 3.2 mi. (a) What percentage of city bus routes ar
Choose the correct answer to complete the sentence. The laws and policies of a theocratic government are based on _____. A. rule by a constitutional monarch
374,000 in standard form