tiffanygomez1234 tiffanygomez1234
  • 24-06-2020
  • Mathematics
contestada

I don't understand can someone help

I dont understand can someone help class=

Respuesta :

875743 875743
  • 24-06-2020

Answer:

C

Step-by-step explanation:

Answer Link

Otras preguntas

Can someone help me do midpoint karel from Codehs in Java Script
in the wind tunnel you measure the total horizontal force acting on the car to be 300 n. is your new design better than the camry design?
Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A:
Research and Find out two ways each in which Programming language and used Form & Scientific Application A Buisness 8 Application
What is the correct tense of we have examinations tomorrow
Compare and contrast the video and the story the fall of the house of usher. Give 10 differences from the story and film.
what are factors influence drainage basin in South Africa​
This is typically considered the return on U.S. government bonds and bills and equals the real interest plus the expected inflation premium. ?
compute σ(n) and µ(n) for each n value below. (a) n = 105 (b) n = 15! (c) n = 79^79
a sales forecast estimates both the number of guests to be served in a specific time-period and the:select one:a.time required to serve them.b.amount each guest