Mikesanz9 Mikesanz9

23-09-2020
Mathematics

contestada

3х — у+ 2x = 4
6x — 2y + 4z = — 8
2x — у+3z = 10

Respuesta :

maddyoldefest maddyoldefest

23-09-2020

1. 5x-y=4
2. -4/3+1/3y-2/3z
3. x=5+1/2y -3/2z
And/or the answer to the whole thing could be that the statement is incorrect.

Answer Link

Otras preguntas

Find the commission on a $750.00 sale if the commission is 24%. $166.00 $180.00 $131.25 $201.00

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

What hormones are related to sodium balance?

Joe has eaten of a pizza. Jane has eaten of a pizza How many times more pizza has Joe eaten than Jane?

1. Obligate anaerobes are often grown in an anaerobe jar, which completely excludes oxygen from the environment. How is the environment within a tube of fluid t

Siri has half the amount of quarts in a gallon how many cups are in those quarts if there are 4 quarts in a gallon

what is the solution of the following question? x^2+10x+25=12

write a sentence using the words limiting factor and carrying capacity

write a sentence using the words limiting factor and carrying capacity

Pedro tapes a 3 5/6 piece of paper to a 2 3/4 inch of piece with no overlap. how long is the piece of paper he made?