JaquezEF8151 JaquezEF8151
  • 24-10-2020
  • Mathematics
contestada

Evaluate 60 ÷ (6 + 9) – 3.

Respuesta :

happylemon1234567 happylemon1234567
  • 24-10-2020

Answer:

1

Step-by-step explanation

60/15=4

4-3=1

Answer Link
kitkatphone66
kitkatphone66 kitkatphone66
  • 24-10-2020

Answer:

1

Step-by-step explanation:

to solve this you are going to follow pemdas.

60÷(6+9)-3

60÷15-3

4-3

1

Answer Link

Otras preguntas

What role does the media play in reporting human rights violations in the right manner
Assuming the average composition of air weighs approximately 0.0807 lbs per cubic foot, what is the weight of air in a giant spherical balloon with a diameter o
In a Worn path by Eudora welty in lines 1-9 what details suggest that phoenix is in for a long journey?
how could you use division to find out how many whole pies are in 11/3 of a pie? explain!!!!!!
What is the answer to 8xsquared-24x
Sam left his school at 3:05. He walked at a speed of 3.2 mph. 15 minutes later, Al started running after him, and he caught up with Sam 10 minutes later. What w
Which scientific advancement is linked to the Muslim scholar Al- Khwarizmi? O A. He discovered new species of life on the ocean floor. B. He developed a unified
find the amount of the discount on a $234 item with a discount of 15% A. $35.01 B. $40.00 C. $23.40 D. $35.10
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
How can one concentrate in studies ?