hayleylove123 hayleylove123
  • 23-11-2020
  • Chemistry
contestada

is Sc2S3 polar or non polar or ionic

Respuesta :

AbScott
AbScott AbScott
  • 23-11-2020

Answer: Ionic

Explanation:

Answer Link

Otras preguntas

what is the solution to the following equation? 9x^2-12x+4=17
The heart sounds S1 and S2 are...?
who is the first presiden of United States?
I need somebody's help..
How many howl ones are equal to 36 quarters
which loan type requires you to make loan payments while you're attending school? A-Unsubsidized federal loan. B-Subsidized federal loan. C-Pell Grant. D-None o
which of the following expressions is equal to 1? a. 5^0 x 6^-3 x 6^3 x 5^1 b. 5^2 x 6^-2 x 6^3 x 5^-3 c. 5^2 x 5^-2 x 6^0 x 6^2 d. 5^-1 x 6^5 x 6^-5 x 5
What event takes place in the second entry of Anne Frank's dairy?
of the 600 workers at a factory, 8.5% belong to a union. how many workers are in the Union?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC