luz64 luz64
  • 25-11-2020
  • Social Studies
contestada

List 10 different things you guys are grateful for

Respuesta :

anxgelicluhv
anxgelicluhv anxgelicluhv
  • 25-11-2020

Answer:

Here is what I'm grateful for:

1. Family

2. Friends

3. My pets

4. Food

5. Water

6. Clothing

7. Shoes

8. Electronics

9. Art things (colored pencils, paper, etc, bc I love to draw)

10. brainly.com

Answer Link

Otras preguntas

What is the power output of an electric motor that lifts a 2.0 kilogram block 15 meters vertically in 6.0 seconds
can I get the answers for number 14 plz?
which of the following does NOT describe the process of summation? a. Two ESPSs are generated at the same time by two separate synapses, bringing the cell to th
Which of the following statements is true? a.People rarely adapt to stress over time. b.Stress is inevitable c.Most people would rather have their stresses of t
Family values in Ancient Rome included obedience to elders and devotion to the gods
how can a driver best be prepare to enter sharp curves
An essay that uses the words first, next, and finally indicates what type of organization?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
explain the conditions for cloud formation
In a monohybrid cross, F2 refers to __________. A)the original mating pair B)the grandparents of the 1st generation C)the 1st filial generation D)the second fil