kmwShasecjam kmwShasecjam

23-10-2016
Mathematics

contestada

Eleven and one half divided by one fourth

Respuesta :

ChocolateDoughnuts ChocolateDoughnuts

23-10-2016

11 and one half divided by one fourth = 46

Answer Link

Otras preguntas

hey i am just clueless

STUDY TIP 1Don't do all your studying the night before. Instead spread it out, review class materials several times a week, and focus on one topic at a time.FOL

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Which of the following are steps in practical problem solving?

Read the topic sentence from asher's analysis of enrique's journey. To demonstrate enrique's intelligence and resourcefulness, nazario depicts his response to t

Given the function, f(x) = x ^ 2 + 9x , find f(- 7)

Use the FOIL method to find the terms of the following multiplication problem. (4+3i) (6-3i)

Which of the following statements are true about energy and bonds? Check all that apply. A. The formation of bonds does not absorb or release energy. B. When bo

what was the significance of the fighting at lexington and concord in 1775?

(WARNING: you will get LOTS on notifications if u answer.)is cereal soup?is a hot dog a sandwich?do penguins have knees?._. i am bamboozled.