23-01-2021
French

contestada

Explain the concept that human wants are insatiable.

Respuesta :

lbmaggi13 lbmaggi13

23-01-2021

we always want more, once we’ve got what we want, it is already insatiable.

Answer Link

Otras preguntas

what type of sentence is used to give a command

The question is in attachment

What's x² + 2x + 1 factorised?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

if if x+y=10, find the value of y when x=3

Solve for a: 2a + 4 = 3a + 2

A problem play focuses on what exactly? Select all that apply. 1. problems in the author's life 2. problems in society 3. problems in life that haven't yet occ

a jet takes 5 3/4 hours to fly 2,475 mi from new york city to los angeles. about how many hours will a jet flying at the same average rate take to fly 5,452 mi

· Heart muscle receives its oxygen and nutrient supply from o atria o ventricles o aorta o pulmonary veins o coronary arteries · The "cushion" between bones in

how to find the average range of cells A1:A10