bailey1920072 bailey1920072

26-02-2021
Mathematics

contestada

Out of a group of 3 people, 2 study French and 1 studies Spanish. Two people are drawn randomly from the group without replacement. Display all possible outcomes as an organized list.

Respuesta :

emma020 emma020

26-02-2021

Answer:

- 1 French, 1 Spanish

- 2 French

Answer Link

Otras preguntas

What was the main purpose of the declaration of independence brainly.

How do trade agreements help the countries involved brainly.

Ron wants to make money painting portraits of people at the local mall. The mall charges Ron $22.00 a day for Ron to set up his materials to sell his portraits.

list ten features of word processing packages

* Why would the phrase "Remember the Maine" lead to more people favoring war with Spain

May anyone give me 3 points that I could include in my paragraph ( I agree with the statement) I need more ideas?

Help help help math math

Read the topic sentence from asher's analysis of enrique's journey. To demonstrate enrique's intelligence and resourcefulness, nazario depicts his response to t

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Please help me solve for n