laylavideau023 laylavideau023
  • 22-03-2021
  • English
contestada

(a)
How does the phrase curves like those of a flower petal in
paragraph 10 of the passage from A Single Shard contribute to the
story?

a How does the phrase curves like those of a flower petal in paragraph 10 of the passage from A Single Shard contribute to the story class=

Respuesta :

Hampton777 Hampton777
  • 22-03-2021

Answer:

c

Explanation:

that is because in the story is says (c) colorful

Answer Link

Otras preguntas

Speculate as to how the information obtained from the sequencing of the human genome might be used to someday eliminate inborn errors of metabolism
Help me w this pls I need it
How do you divide an fractions
URGENT PLEASE HELP! A German Shepherd weighs 24 pounds and is gaining ten pounds each month. A rottweiler weighs 60 pounds and is gaining 4 pounds each month. H
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
What are at least two ways this image my affect demand?
All of the following may help begin an ice age EXCEPT _____. A. volcanic eruptions B. Earth's revolution around the Sun C. clustering of continents near the
Adjectives _____nouns and pronouns
Aside from targeting Verizon customers, Sprint could pursue __________, as they make up the largest group to use mobile devices for any type of transaction.
In the story the origin of the green ninja how does the setting contribute to the plot of the story