23-03-2021
Mathematics

contestada

A(5,1)B(x,7) C(8,2) are three points such that AB=2AC find all values of x

Respuesta :

leilichong leilichong

23-03-2021

Wrongggggggggggggggggggggg

Answer Link

Otras preguntas

Mantle convection is a circulation of heat emitted by the earths... A) core B) crust C) lithosphere D) atmosphere

What does Holden have against bald men?

how to get the answer to this equation 1+4=5 2+5=12 3+6=21 8+11=?

PLEASE HELP AND EXPLAIN!!! (ASAP) A freight train left Seoul and traveled north at an average speed of 15.6 km/h. A passenger train left 3.9 hours later and tra

choose the correct helping verb the tadpoles have or had moved into the pond

which of the following expressions is equal to 1? a. 5^0 x 6^-3 x 6^3 x 5^1 b. 5^2 x 6^-2 x 6^3 x 5^-3 c. 5^2 x 5^-2 x 6^0 x 6^2 d. 5^-1 x 6^5 x 6^-5 x 5

choose the correct helping verb the tadpoles have or had moved into the pond

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Sarabeth ran 1 2/5 miles on a path around the park. This was 5/8 of the distance around the park. What is the distance around the park.

PLEASE HELP ME AASSAPP