24-03-2021
History

contestada

What was the period called where all the states were fighting?

Respuesta :

baldishkaur309 baldishkaur309

24-03-2021

Answer:

American Civil War, it was a 4-year war (1861–1865).

Explanation:

Answer Link

iamcreative iamcreative

24-03-2021

American Civil War..........

Answer Link

Otras preguntas

The height in inches of three boys is 54.0 48.5 46.0 respectively the height of the 4th boy is denoted by h inches the average height a of the 4 boys can be exp

Dory and Nemo go to Taco Bell for lunch. Dory orders three soft tacos and three double deckers for $11.25. Nemo pays $10.00 for four soft tacos and two Double D

what is the solution to the following equation? 9x^2-12x+4=17

to increase an amount by 85% what single multiplier would i need to use?

which one of the statements is true

How do I do this? tell me the answer and how you got it.....I have to graph this later

1+4=52+5=123+6=218+11=?

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

1. Explain the different forms of child abuse? Include Shaken Baby Syndrome in your response.

Look At The Picture. Thats The Question I Need Answered ASAP