travynbland travynbland
  • 22-04-2021
  • Mathematics
contestada

solve -4x/x-1+2x+6/x^2-1=1

Respuesta :

wsp23456
wsp23456 wsp23456
  • 22-04-2021

Answer:

Step-by-step explanation:

6/x^2 + 2 x = 7

2 x^3 - 7 x^2 = -6 (for x!=0)

(2 (x^3 - 3 x^2 + 3))/x^2 = 1

Answer Link

Otras preguntas

solve the sinusoidal equation: 5sin(3x)-1=3
The written price of a shirt is Rs. 275. If 15% rebate is given on the written price, what will a customer pay? Please answer in the simpliest way
if I were to legalize a document in Thailand would it have to be in the national language thai
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
What are two ways that the legislative branch checks the executive branch in the selection of judicial appointees? The Senate Judiciary interviews judicial appo
What is the purpose of the chemical ammonia (NH3) in hair dyes?
You see a whiteboard that has “8-10 years olds, interested in horses” written on it. This is MOST likely a description of: A. data management. B. target users
Explain the conditions of Russia during the First World War
Which of the following is an example of an incremented sequence? A. 1, 2, 3, 4 B. 4, 3, 2, 1 C. North, South, East, West D. A, B, C, D
Which major work does an archaeologist do? a. unearths physical materials from human settlements b. teaches about fossils and dinosaurs c. interviews people abo