mikevell3 mikevell3

25-05-2021
Mathematics

contestada

Given the sequence 8, 16, 32, 64, ..., which expression would give the thirteenth term?

8 · 2 12
8 13
8 · 2 13
need its now being timed

Respuesta :

johsal18 johsal18

25-05-2021

Answer:

it would be 8 times 2^13

Step-by-step explanation:

Answer Link

ggg5816ihgg ggg5816ihgg

25-05-2021

8.2.12 seedsmffkfkrkrkekekekekkejejdhdhbhfbrhdhhfhfufudu

Answer Link

Otras preguntas

last week, dave predicted his weight at his physical would be 164 lbs. At the doctor’s his actual weight was 175 lbs. what was the percent of error in Dave’s es

Can you guys help me

Marc drove 312.8 miles on 12.5 gallons of gas. What was the car’s average mileage miles per gallon for the distance.

In(3x-1)+4 i don't know the answer

Please help me asap ty :)

Any ideas for this…?

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

How many 1/2 -yard lengths are in 1 yard?

If x is equal to 9 and y is equal to -3, then what is the value of…….? x - 9y - 3x + 6y -13?

How many beads would the jeweler need to make 10 bracelets?