ericn9683
ericn9683 ericn9683
  • 23-08-2021
  • History
contestada

I need help asap!!
10 points

I need help asap 10 points class=

Respuesta :

htetnaing2020pol
htetnaing2020pol htetnaing2020pol
  • 04-09-2021

Answer:

In the Treaty of Paris, the British Crown formally recognized American independence and ceded most of its territory east of the Mississippi River to the United States, doubling the size of the new nation and paving the way for westward expansion.

Answer Link

Otras preguntas

what would you call a object that makes people shut up
Matt had to write 3 4/12 as an improper fraction right how you would tell Matt the easiest way to
how to solve these question?
Sarabeth ran 1 2/5 miles on a path around the park. This was 5/8 of the distance around the park. What is the distance around the park.
Juliana’s exercise partner is running a high fever and feels nauseous. She also has a rapid heart rate. What should Juliana do? Get warm food Stay in the sun
What shape have at least 2 parallel sides
what mass of iron 3 chloride contain 2.35 x 10 to the 23rd chloride ions
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
How can one concentrate in studies ?
approximately how long does it take the moon to complete one orbit around earth