21delacruzelijah 21delacruzelijah

22-09-2021
Mathematics

contestada

Which of the following is equivalent to 5 (3x + 2)

Respuesta :

JacksonTheGreat07 JacksonTheGreat07

22-09-2021

Answer:

X=1

(3(1)+2)

3+2

5

Answer Link

Otras preguntas

What is one of the main differences between the phosphorus and sulfur cycles? A) Plants absorb phosphorus mainly from the air and sulfur mainly from the soil

how would living in Sparta or Athens be like

what would you call a object that makes people shut up

6 is 12% of what number

Family values in Ancient Rome included obedience to elders and devotion to the gods

What is the significance of the similar number and arrangement of bones in a human arm and a bat wing?

choose the correct helping verb the tadpoles have or had moved into the pond

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

Which force brought together the material from the nebula to form the solar system? A. electromagnetism B. strong nuclear force C. weak nuclear force D. g

Which statement is true for single-celled organisms