00060904
00060904 00060904
  • 23-02-2022
  • Mathematics
contestada

How do i do this problem

How do i do this problem class=

Respuesta :

reinhard10158
reinhard10158 reinhard10158
  • 23-02-2022

Step-by-step explanation:

(0 + a) = a

due to the addition property of zero.

what remains is

a + 8

Answer Link

Otras preguntas

When a cell related to immunity activates only in reaction to a specific pathogen, it is called _____. (Points : 4) inducibility clonality lymphocytes T lymphoc
A department store purchases a dress for $80. To sell the dress to customers, the price is marked up by 19%. You hand the clerk $110. How much change will you
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
how much heat in kj is released by burning 9.5 grams of methane?
1. Obligate anaerobes are often grown in an anaerobe jar, which completely excludes oxygen from the environment. How is the environment within a tube of fluid t
Water and minerals can follow three pathways to the vascular tissue of the root. Describe the three pathways.
why can't the position of an electron be determined with certainty?
The election of 1800 demonstrated that the Alien and Sedition Acts were constitutional. the electoral college worked smoothly. the US government was stable. pre
Make a word rearranging the following letters: C O P E S O R I M M
blank thousands equals 1800 tens