s3hemmaJoanah s3hemmaJoanah

24-01-2017
Mathematics

contestada

Two dozen cookies require 3 cups of flour.how many dozen cookies can be made with 15 cups of flour?

Respuesta :

jennzyh jennzyh

24-01-2017

10 dozen cookies can be made

Answer Link

Otras preguntas

. How should President Kennedy respond to the Soviet Arms Buildup in Cuba?

to find detailed information about the origin of an email message, look at the ________________.

how was the founder of connecitcut

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

A production line operation is designed to fill cartons with laundry detergent to a mean weight of 32 ounces. A sample of cartons is periodically selected and w

Help help math math math

is the pair of complementary angles are in the ratio4:11 find them

On May 3, what is the balance of the Equipment Office account? A. Debit $5,090 C. Debut $4,400 B. Debit $690 D. Credit $5.090

Can someone help me with this please

Can i get some help :