eddrekas3375 eddrekas3375
  • 25-03-2022
  • English
contestada

Roberto is sure to win an art scholarship. roberto is a talented portrait artist.​

Respuesta :

iamatodler
iamatodler iamatodler
  • 25-03-2022

1. theres no question

2. if Roberto was talented he would be able to do more than just portrait art

3. Roberto can't be too sure about that. you never know when disasters gonna strike and theres no proof of this "talent"

and 4. you sound like his mom.

Answer Link

Otras preguntas

omega 3 fatty acids are important because they
When is cash pulled out of circulation
write the complete thermochemical equation (including energy) for the combustion of hexane.
a balanced relationship between the energy that you intake and your body's energy output is the definition of what
Juliana’s exercise partner is running a high fever and feels nauseous. She also has a rapid heart rate. What should Juliana do? Get warm food Stay in the sun
Tell whether the given value is a solution to the inequality. -2.4m>-6.8;m=-3
In a population of skunks, there are striped and stripeless individuals. Stripes are dominant to the absence of stripes. In this population, p = 0.8 and the fre
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
The answer to 5+5×5+5=
What is the layer of the earth where mantle convection occurs and on which the earth's crust rests?