eguriase
eguriase eguriase
  • 23-02-2017
  • Biology
contestada

What is an organic acid.

Respuesta :

atomickitten
atomickitten atomickitten
  • 23-02-2017
An organic acid is an organic compound with acidic properties.
Answer Link
gaabynicole gaabynicole
  • 23-02-2017
organic acids are organic compounds that possess acidic properties.
Answer Link

Otras preguntas

Reasons why healthcare is expensive in the us - check notes - lack of price transparency, - research and development
Sketch a graph of the polynomial function f(x) = x³ + 4x² + 3x. Use it to complete each statement. • f(x) is · D . f(x) is f(x) is Choose... Choose... Choose...
what are some experiments for which you might want a lower alpha level (e.g., 0.01)?
Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul
a rope goes from one building to another. the distance between the buildings is 12 m, and the rope is tied to each building at a point 8 m and 3 m high above th
Recall that the exponential distribution with parameter> 0 has density g(x) = de- , (> 0). We write X-Exp (2) when a random variable X has this distributi
create a class named library that has a name and address with their setters and getters create an item class that has title and price the item can be book or ma
you want to modify the value of the default textview control in a new android app, what should you do?
Zodiacs sign histories
Which graph represents the solution set of the system of inequalities?