kellhudsmiAbbyluvm kellhudsmiAbbyluvm

25-02-2017
Chemistry

contestada

What is the name of thr substance that any wave travels through?

Respuesta :

Adrian131 Adrian131

25-02-2017

it is known as the medium

Answer Link

Otras preguntas

At the start of Year6 Company began construction on a new office building. Company computed interest on weighted average construction expenditures during Year6

Revise the following sentences, inserting colons or semicolons where appropriate:1. I learned all the rules and regulations of basketball however, I never reall

The use of energy by-products from one process as the primary energy source for another process is referred to as ____.

What is the most likely outcome for the number of green lights that Nicholas encounters on his morning drive to school? How often will he encounter this number

Chronological order of el Salvador history

In keeping with italian traditions, __________ wrote his _________, the barber of seville (1816), with a down to earth plot about love with a ______________.

An outpouching of an alveolar sac which leads to subsequent rupture resulting in a pneuothorax is called:

A 2-day-old infant was just diagnosed with aortic stenosis. What is the most likely nursing assessment finding?

What new political party rose in oppo- sition to president andrew jackson? what was the party's attitude toward the power of the president?

4. PCR Primer design (4 points) You have a piece of DNA that includes the sequence: 5'GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT 3' To amplify this