Winter616 Winter616

26-03-2015
Mathematics

contestada

Type the equation that shows the pattern among this set of ordered pairs (0,2) (1,-1) (2,-4) (3,-7)

Respuesta :

konrad509 konrad509

26-03-2015

[tex]y=-3n+2[/tex]
...................

Answer Link

Otras preguntas

The radius of the planent venus is nearly the same as that of the earth,but its mass is only eighty percent that of the earth. If an object weighs w on the eart

6. The probability that a baby will be a boy is ½ as is the probability that a baby will be a girl. Explain this fact by explaining the mechanism of meiosis in

If the area of a rectangle is 40" and the perimeter is 48", what are the side lengths of the rectangle?

What is the source Code of transcription

A storage unit is in the shape of a cube with 8 feet edge lengths what is the surface area of the storage unit

Mantle convection is a circulation of heat emitted by the earths... A) core B) crust C) lithosphere D) atmosphere

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

The spread of ideas during the Renaissance was MOST affected by. A) luthers religious conversion. B) the support of the Catho

In a parking lot there are motorcycles and cars. You count 98 wheels, and your friend counts 30 vehicles. How many cares are there? How many motorcycles? Assign

What does the equation -355-n=-957 what does n equal?