21-03-2024
Mathematics

contestada

using the divisibility rules what numbers is 2, 346 divisible by?

Respuesta :

wherschberger4063 wherschberger4063

21-03-2024

it is 2,3 and 6

the explanation is to divide by each number untill you get the anwer

Answer Link

Otras preguntas

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A:

I need help please. This is education class

6 Substantive mit artikel

7 Use the fact that the derivative of the function f(x) = is f'(x) = - is 1'(x) = to find the equation of the tangent line to the graph of f(x) at the point x =

Inputs: People at concession stand Outputs: Cost of their order this relation a function? it a constant function? it a 1-1 function?

El hombre caimán es regional, nacional o universal

(a) Find the equation of the plane p containing the point P (1,2,2) and with normal vector (-1,2,0). Putz, y and z on the left hand side and the constant on the

A good example of an industry that is nearly perfectly competitive is the market for. A.pharmaceutical drugs. B.utilities. C.ice cream. D.clothes. E.apples.

When comparing the IR spectra of the two compounds below, what absorption (s) would allow you to distinguish the compounds? HC almostequalto CCH_2N (CH_2CH_3)_2

What is the domain of the exponential function shown in the graph? -8 -6 N -2 8 6 4 2 2+ + 6 2 6 -00 8 Y X