adensimpson2002 adensimpson2002

25-09-2015
Mathematics

contestada

What is equal to -15?
a) -5+10 b)-5-10 c)-5+(-10) d) -5-(-10)

Respuesta :

crisforp crisforp

25-09-2015

- 5 + 10 = 5 ( False )
- 5 - 10 = - 15 ( True )
-5 + ( - 10 ) = - 15 ( True )
-5 - ( - 10 ) = - 5 + 10 = 5 ( False ) ;
The correct answers are b) and c).

Answer Link

Otras preguntas

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Write a letter to your father who is in aboard asking better study. him money for your

. True or False: It is possible with feedback control to obtain a stable closed-loop system even when the underlying open-loop system is unstable and not accura

Decide if the following sentence is grammatically correct or incorrect. Ella hablaría con su madre. Correct incorrect.

I need help asap pls

What is the correct way to write 1,550,000,000 in scientific notation? 1. 55 times. 109 1. 55 times. 1010 15. 5 times. 108 15. 5 times. 109.

Please answer this question fast

what is the price of this jacket ?

In the viable plate count method, a measured sample of a culture is evenly spread across an agar surface and incubated. Each __________ on the agar surface repr

One way that medical professionals communicate and keep track of their patient’s health care is through the use of electronic medical records. Instead of a pape