shykeilad shykeilad

23-01-2018
Computers and Technology

contestada

to understand the full scope of program requirements it would be best to consult the

Respuesta :

StrongBad StrongBad

25-01-2018

project plan, perhaps?

Answer Link

BenitoMarin BenitoMarin

19-01-2020

Answer:

The correct answer is: program outline.

Explanation:

Program outlines are handbooks that offer information in detail of the functionality of diverse programs and what are the requirements the sever must meet to run the software. It is a helpful tool to use when information about the software is unknown or there is doubt about how to work with it.

Answer Link

Otras preguntas

Where are the asymptotes for the following function located? f (x) = startfraction 7 over x squared minus 2 x minus 24 endfraction

select all the techniques igor stravinsky used to create novel harmonies and make conventional chords sound unique. multiple select question. deconstruction orc

Which one among these is the least useful measure for comparing health care expenditures across countries? A. per capita expenditure on health care services B.

Which of the following is not a type of information included in the covariation model of attribution?

During mr. Nye's science class, students were expected to identify various substances using physical properties they could easily measure. Mr. Nye gave each of

One of your customers wants to build a personal server that he can use in his home. One of his concerns is making sure he has at least one back up of their data

you test the hypotheses vs by using the test find the smallest threshold so that the test has asymptotic level . note that here we are choosing a test so that d

When a logistic regression coefficient is negative, the exponentiated coefficient, i.e. the EXP(B), will always be less than one. True or False

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

find the area of the region enclosed by the inner loop of the curve. r = 4 + 8 sin θ