nana11pooh
nana11pooh nana11pooh
  • 23-04-2018
  • Mathematics
contestada

can anybody help with this

can anybody help with this class=

Respuesta :

lexie2662
lexie2662 lexie2662
  • 23-04-2018
100 =d


your welcome lol
Answer Link

Otras preguntas

If you drink a soda with sugar, what happens to your blood glucagon levels?
as a medical administrative assistant at Saint Catherine Children’s Hospital, write an email message to your supervisor that will be read on a mobile device de
if a neuron had a mutation that prevented the production of voltage gated Na+ channels, what function would the neuron NOT be able to accomplish?
The election of 1800 demonstrated that the Alien and Sedition Acts were constitutional. the electoral college worked smoothly. the US government was stable. pre
In a Worn path by Eudora welty in lines 1-9 what details suggest that phoenix is in for a long journey?
A patient comes into the clinic with a resting heart rate of 80 beats per minute (bpm). The patient's cardiac output was found to be 5.6 liters/minute with an e
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
0-4+7-5×3÷9×5-4 do the sum of that mathematics...
A cubic centimeter holds 1 milliliter of liquid. How many liters of water to the nearest tenth are required to fill a fish tank that is 24 centimeters high, 28
Which situation CANNOT be represented by this equation? -1\4x + 14 = 8 A) A hot-air balloon has a 14-foot diameter that each 1\4 of an hour gets steadily smal