Aunae
Aunae Aunae
  • 22-02-2021
  • Mathematics
contestada

Pls help...no idea :/
I would really appreciate it

Pls helpno idea I would really appreciate it class=

Respuesta :

misterturtl
misterturtl misterturtl
  • 22-02-2021

Answer:

12

Step-by-step explanation:

Answer Link

Otras preguntas

Which statements accurately describes how to be determine the y-intercept and the slope from the graph below? To find the y-intercept, begin at the origin and m
what is the solution (x,y) to the system of equations below? 3x+4y=-23 2y-x=-19 A) (-5,-2) B) (3,-8) C) (4,-6) D) (9,-6)
please add how you got the answer
4. Translate the following RNA sequence into a protein chain. AUGGUUACCAGUCGCUUAUAA Please
What is the equation of the circle passing through the point (6,5) and centered at (3.-4)?
25 points and brainly please help quickDoug records how many miles and how long he rides his bike each day on a scatter plot.Doug analyzes his data on the scatt
PLZ HELP AND HURRY!! IM GIVING 50 POINTS!!!!!! HURRY PLZ!! Plot A shows the number of hours ten girls watched television over a one-week period. Plot B shows th
If the odds in favor of an event happening are 3-7, what is the probability of Sant that event happening?
Hey ich bräuchte bitte mal hilfe bei a) und b) !??
What is the value of X?